CH02h11a
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH02h11a.F | CGTGGCATGCTTATCATTTG | 20 nt | 56.4 °C | ![]() |
|
CH02h11a.R | CTGTTTGAACCGCTTCCTTC | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 104-132 | ||||
Number of alleles detected | 8 | ||||
Expected heterozygosity | 0.83 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 120 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-4 Fiesta-4 Fiesta x Totem-4 Malling9-4 Robusta5-4 Apple Integrated Map-4 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH02h11a aattaataagtgaagcaagaaatgccgatcagataaagactttggtgaaaatgtgagtgagagtgaacgtggcatgctta tcatttgtggaaaatagtttcagagttgagagagagagagagagagagagagagaggtagcgagtctaaagcaagaagtg aaggggagaaggaagcggttcaaacagttacagtggctccatctggagtagcgatttagactcaactcttgattcccttg kgttttgctgtcgccttcctttccactcggactcggctttttgccacgtctacaaatgttctcagaaacggccataagtt atggcttgggctccaaaaacactgaatcctcttgaacctaaatt | |||||
User's notes | |||||
Luca Gianfranceschi (luca.gianfranceschi@unimi.it) Date 13 September 2005 - Time: 15:09 Forward primer sequence was wrong. Please use the new one. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
124:130 104:128 124:128 122:128 120:130 130:132 128:132 |

