CH02h11a
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH02h11a.F | CGTGGCATGCTTATCATTTG | 20 nt | 56.4 °C |  |
|
| CH02h11a.R | CTGTTTGAACCGCTTCCTTC | 20 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 104-132 | ||||
| Number of alleles detected | 8 | ||||
| Expected heterozygosity | 0.83 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 120 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery-4 Fiesta-4 Fiesta x Totem-4 Malling9-4 Robusta5-4 Apple Integrated Map-4 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH02h11a aattaataagtgaagcaagaaatgccgatcagataaagactttggtgaaaatgtgagtgagagtgaacgtggcatgctta tcatttgtggaaaatagtttcagagttgagagagagagagagagagagagagagaggtagcgagtctaaagcaagaagtg aaggggagaaggaagcggttcaaacagttacagtggctccatctggagtagcgatttagactcaactcttgattcccttg kgttttgctgtcgccttcctttccactcggactcggctttttgccacgtctacaaatgttctcagaaacggccataagtt atggcttgggctccaaaaacactgaatcctcttgaacctaaatt | |||||
| User's notes | |||||
| Luca Gianfranceschi (luca.gianfranceschi@unimi.it) Date 13 September 2005 - Time: 15:09 Forward primer sequence was wrong. Please use the new one. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
124:130 104:128 124:128 122:128 120:130 130:132 128:132 |
||||
Send comments to Luca Gianfranceschi
