CH03a08
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH03a08.F | TTGGTTTGCTAGGAAAAGAAGG | 22 nt | 58.4 °C | ![]() |
|
CH03a08.R | AAGTTTATCGGGCCTACACG | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 146-218 | ||||
Number of alleles detected | 7 | ||||
Expected heterozygosity | 0.75 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 185 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-13 Fiesta-13 Malling9-13 Robusta5-13 Apple Integrated Map-13 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH03a08 aattcaacttctcacttcattaaatgcatgtctggctggattatcacgtgaacttaaggccttagggtttatttccttcc taactagattggttggtttgctaggaaaagaaggaaacaaggttctctttctccctctctctctctctctctctctctct ctctctctctctcaaacttactcatgtggacttcaaagattatgggcttggatctttaggcccccaancaacccaaagtc ttccataatcttgactccgtgtaggcccgataaacttgtaaccatccacatcacaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
146:186 186:218 164:172 146:192 146:186 146:186 186 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)