CH03a09
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH03a09.F | GCCAGGTGTGACTCCTTCTC | 20 nt | 62.5 °C |  |
|
| CH03a09.R | CTGCAGCTGCTGAAACTGG | 19 nt | 59.5 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 125-143 | ||||
| Number of alleles detected | 6 | ||||
| Expected heterozygosity | 0.76 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 143 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery x TN10-8-5 Discovery-5 Fiesta-5 Fiesta x Totem-5 Malling9-5 Robusta5-5 Apple Integrated Map-5 M.27 x M.116-5 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH03a09 aattgtttccctttatattttcatccacccgtggtagtgtgaaatccatctccagagctctcaccttcactctgtttcca tggtctggtctggatttaatccccaaacaaatctttgaaatccaacctcaaccaatcagattcaaccaaactgccaggtg tgactccttctccaccaataccattaaaaactggccagatgatattccaacaganaaaaacctctctctctctctctctc tctctctctctctctctctctctccaaaaaaccatgccagtttcagcagctgcagctctgcantcatctctctgcttctc ttctaacaatccatcatcttcttctgatttggacacccaactggncgcaaaacccaaaagcctgctccacaancatcctc tctacacacccacccacannaaactctccctccaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
131:135 125:131 131:135 135:143 131:143 139:143 131:135 |
||||
Send comments to Luca Gianfranceschi
