CH03a09
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH03a09.F | GCCAGGTGTGACTCCTTCTC | 20 nt | 62.5 °C | ||
CH03a09.R | CTGCAGCTGCTGAAACTGG | 19 nt | 59.5 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 125-143 | ||||
Number of alleles detected | 6 | ||||
Expected heterozygosity | 0.76 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 143 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery x TN10-8-5 Discovery-5 Fiesta-5 Fiesta x Totem-5 Malling9-5 Robusta5-5 Apple Integrated Map-5 M.27 x M.116-5 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH03a09 aattgtttccctttatattttcatccacccgtggtagtgtgaaatccatctccagagctctcaccttcactctgtttcca tggtctggtctggatttaatccccaaacaaatctttgaaatccaacctcaaccaatcagattcaaccaaactgccaggtg tgactccttctccaccaataccattaaaaactggccagatgatattccaacaganaaaaacctctctctctctctctctc tctctctctctctctctctctctccaaaaaaccatgccagtttcagcagctgcagctctgcantcatctctctgcttctc ttctaacaatccatcatcttcttctgatttggacacccaactggncgcaaaacccaaaagcctgctccacaancatcctc tctacacacccacccacannaaactctccctccaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
131:135 125:131 131:135 135:143 131:143 139:143 131:135 |
Send comments to Luca Gianfranceschi