CH03b01
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH03b01.F | ACAAGGTAACGTACAACTCTCTC | 23 nt | 61.1 °C |  |
|
| CH03b01.R | GTCACAAAACCGCCAGATG | 19 nt | 57.3 °C | ||
| SSR info | |||||
| SSR repeat type | Imperfect | ||||
| Locus type | presumed multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 160-180 | ||||
| Number of alleles detected | 6 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 176 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Fiesta x Totem-2 M.27 x M.116-2 M.27 x M.116-15 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH03b01 aattcgaacaaggtaacgtacaactctctctctctctctctcnctctctctctctctctctatttctctgtcattcgatc ttcgattaccgttgcaattgatgtgtaatggatctnggtangatccnaattgcaggcgtactttttcnganatggcgggc ggcgcatctggcggttttgtgacaaaancattcgantctaagctcaangagtgcgctccgaanancatgcatatcttcag aangctattcgcgcttatttacgtttcnttctgattcccttgtgaatacacttatgcataaacattgcgtnttcgcatgt attttttggactntggannatcangtgtttactttggttgngagattgttgaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
160:166:178 162:166:178 162:166:178 162:166:178 160:172:180 160:180 180 |
||||
Send comments to Luca Gianfranceschi
