CH03b06
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH03b06.F | GCATCCTTGAATGAGGTTCACT | 22 nt | 60.3 °C |  |
|
| CH03b06.R | CCAATCACCAAATCAATGTCAC | 22 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | Imperfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 111-131 | ||||
| Number of alleles detected | 5 | ||||
| Expected heterozygosity | 0.73 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 123 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery-15 Fiesta x Totem-15 Apple Integrated Map-15 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH03b06 aattcacgaaggacgttgttgagaccatggcatccttgaatgaggttcactctctcactctctctctctctctctctctc tctctctctctctctctttctcgctatctcatatgcgatgatcaccgcaagtgacattgatttggtgattggcatgcana aaccacttatccttgctctttccaacccaacatcgcaagctgagtgtactgctgaagaagcttacacatggaccaaggta atcaatacgctccttctttccttccctttctcttttctctaagtttcatttgggttataatgcggctatataaaccagca gaaccctgtttaacaatcatatcgtttttctcatacgaagggtcgagcaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
117:131 115:117 111:117 111 111 111:121 111:121 |
||||
Send comments to Luca Gianfranceschi
