CH03d07
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH03d07.F | CAAATCAATGCAAAACTGTCA | 21 nt | 53.5 °C | ![]() |
|
CH03d07.R | GGCTTCTGGCCATGATTTTA | 20 nt | 56.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 186-226 | ||||
Number of alleles detected | 8 | ||||
Expected heterozygosity | 0.8 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 201 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta-6 Discovery-6 Fiesta-6 Fiesta x Totem-6 PI 613988-6 Royal Gala-6 Robusta5-6 Apple Integrated Map-6 M.27 x M.116-6 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH03d07 aattcaaatcaatgcaaaactgtcattgacaatatgtactctctctctctctctctctctctctctctctctctctctat ttagtaactaggcagtctanaacaccgagctgaatgcttactggtcaatgtacacagtttggtcaatgtacacagtttga tttgataagtcccctagttatggaataaaatcatggccagaagccccattttctcaataaatattcttaacaaactccac gggtggcatgcacaaaatctagaaagtttaccagtgaatcaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
206:218 206:218 186:206 206:216 190:202 192:206 206:226 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)