CH03d07
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH03d07.F | CAAATCAATGCAAAACTGTCA | 21 nt | 53.5 °C |  |
|
| CH03d07.R | GGCTTCTGGCCATGATTTTA | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 186-226 | ||||
| Number of alleles detected | 8 | ||||
| Expected heterozygosity | 0.8 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 201 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Fiesta-6 Discovery-6 Fiesta-6 Fiesta x Totem-6 PI 613988-6 Royal Gala-6 Robusta5-6 Apple Integrated Map-6 M.27 x M.116-6 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH03d07 aattcaaatcaatgcaaaactgtcattgacaatatgtactctctctctctctctctctctctctctctctctctctctat ttagtaactaggcagtctanaacaccgagctgaatgcttactggtcaatgtacacagtttggtcaatgtacacagtttga tttgataagtcccctagttatggaataaaatcatggccagaagccccattttctcaataaatattcttaacaaactccac gggtggcatgcacaaaatctagaaagtttaccagtgaatcaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
206:218 206:218 186:206 206:216 190:202 192:206 206:226 |
||||
Send comments to Luca Gianfranceschi
