CH04f10
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH04f10.F | GTAATGGAAATACAGTTTCACAA | 23 nt | 55.7 °C |  |
|
| CH04f10.R | TTAAATGCTTGGTGTGTTTTGC | 22 nt | 56.5 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 144-254 | ||||
| Number of alleles detected | 9 | ||||
| Expected heterozygosity | 0.88 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 200 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery x TN10-8-16 Discovery-16 Fiesta-16 Fiesta x Totem-16 Malling9-16 Robusta5-16 Apple Integrated Map-16 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH04f10 aattagttaactttggtgtttatgtataaatactgattgtacacataatcttaatgtaatggaaatacagtttcacaatt ctctctctctctctctctctctctctctctctctctctctctctctctctctctctgatgccttgccaatgcttagcaaa gagagcaacgctttcccttcattcatttgttgggtttgataaaaggatggcatgtctagagatacggcagaccgcaaaac acaccaagcatttaaaagactcatacatgtgtgtatgcagtaaagagattctctcattctcaggtcttaanaanttagtg ccaatgaaggtattttctgtttatctatcttttacttctcaaactgaaaaactcaatgcatgcataactaacctattata tagtgtaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
175:238 232:244 244:246 238 195 254 195:144 |
||||
Send comments to Luca Gianfranceschi
