CH05a02
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH05a02.F | GTTGCAAGAGTTGCATGTTAGC | 22 nt | 60.3 °C | ||
CH05a02.R | TTTTGACCCCATAAAACCCAC | 21 nt | 57.4 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | 111-135 | ||||
Number of alleles detected | 7 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 126 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery x TN10-8-8 Fiesta-8 Discovery-15 Fiesta-8 Fiesta-15 Fiesta x Totem-8 Fiesta x Totem-15 Apple Integrated Map-8 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH05a02 aattgtaaggtgaggagaaaaagatcggggaccttgcgcttgagattgtagcggtgccattcggacttgtaatggagctt ctgctccgagtcgtccanaaactccttgttgcaagagttgcatgttagccctgacattctctctctctctctctctctct ctctctctctctctgtggtttgggataccacngaagaagaaagaggcggcgggtgggttttatggggtcaaaaaaaacgt tncaacggctcgcantcggtgacaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
115:125:129 111:115:125:135 115:117:135:135 115:125:129 115:117:129 115:129:135 115:117:135 |
Send comments to Luca Gianfranceschi