CH05b06
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH05b06.F | ACAAGCAAACCTAATACCACCG | 22 nt | 60.3 °C | ![]() |
|
CH05b06.R | GAGACTGGAAGAGTTGCAGAGG | 22 nt | 64.0 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | 138-226 | ||||
Number of alleles detected | 14 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 170 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery x TN10-8-10 Discovery x TN10-8-5 Discovery-5 Fiesta-5 Fiesta-16 Fiesta x Totem-10 Fiesta x Totem-16 Apple Integrated Map-5 Apple Integrated Map-10 M.27 x M.116-3 M.27 x M.116-10 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH05b06 aattccttatgcacggtacatccatctcccccagttgtctccccccctctctcccctcatcagaacccagaaaaaacaag caaacctaataccaccgccaaacacacacccaacacaccctgggacctccttctgcatctctctctccctctctctctat ctctctctctctctctctctctctctctctctctacccatttcgctctgcacccctggaactccctctgcaactcttcca gtctccccacagaaaaatgaaaatccgcaccttgggttttttccttggtttgccgttgctttctgggttttgttttatat gtttgtttttgtttatgctgttagctccggaaatccaatgtttgtcacccgggaaaaaaactccaacgaaaatt | |||||
User's notes | |||||
Luca Gianfranceschi (luca.gianfranceschi@unimi.it) Date 24 November 2005 - Time: 17:23 This markers has been mapped only on the alternative maps Calenge_TAG110_DT5==>CH05b06a and Calenge_TAG110_DT10==>Ch05b06b. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
172:174 164:174:220 138:160:174:226 154:164:174:220 164:174 140:164:174:214 164:222 |

