CH05c06
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH05c06.F | ATTGGAACTCTCCGTATTGTGC | 22 nt | 60.3 °C | ||
CH05c06.R | ATCAACAGTAGTGGTAGCCGGT | 22 nt | 62.1 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 104-126 | ||||
Number of alleles detected | 8 | ||||
Expected heterozygosity | 0.82 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 122 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-16 Fiesta-16 Fiesta x Totem-16 PI 613988-16 Royal Gala-16 Malling9-5 Robusta5-16 Apple Integrated Map-16 M.27 x M.116-16 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH05c06 aatttcatctgcttgtattggaactctccgtattgtgcttagtgtatctcctctctctctctcactctctctctctctct ctctctctctctctctctctctctccagagttgcctaccggctaccactactgttgattgatataaatccaacgccatac ccacaaaagaagtatatatcagtattcacagttaataatcgtagatagtattatggagattccattcttcacgttgcttt gctttctaatcctctccgttttgctaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
104:110 104:118 106:114 104:126 118:126 118:120 118:126 |
Send comments to Luca Gianfranceschi