CH05e03
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH05e03.F | CGAATATTTTCACTCTGACTGGG | 23 nt | 61.1 °C |  |
|
| CH05e03.R | CAAGTTGTTGTACTGCTCCGAC | 22 nt | 62.1 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 158-190 | ||||
| Number of alleles detected | 10 | ||||
| Expected heterozygosity | 0.87 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 191 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | A722-7 x Golden Delicious-2 Discovery-2 Discovery x TN10-8-2 Prima-2 Regia x Pingo-2 Regia x Piflora-2 Discovery-2 Fiesta-2 Fiesta x Totem-2 PI 613988-2 Royal Gala-2 Malling9-2 Robusta5-2 Apple Integrated Map-2 M.27 x M.116-2 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH05e03 aatttctgtataccgaatattttcactctgactgggttaacatttactcattagaagaactctgagagagagagagagag agagagagagagagagagagagagagagagagagagttgagaggacgaggaggagaaagcccnccgaagtatgagacttt gtacatctagcactctagcagagtcggagcagtacaacaacttggtcactgcttcagcttttactaaaagttgccaangg ggccggaagtcacaaaagcgccnacgaaatttgggataaatgtccatatttaaaagcgtcctttatntttcnccnatgcg ttaaatataacgttattattattttattttctctcctccttagtgtttaagttggaagctcnccccaaaataatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
176:182 162:182 182:190 166:174 162:188 162:188 186:188 |
||||
Send comments to Luca Gianfranceschi
