CH05e04
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH05e04.F | AAGGAGAAGACCGTGTGAAATC | 22 nt | 60.3 °C |  |
|
| CH05e04.R | CATGGATAAGGCATAGTCAGGA | 22 nt | 60.3 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | presumed multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 153-234 | ||||
| Number of alleles detected | 9 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 164 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery x TN10-8-16 Discovery-16 Fiesta-16 Fiesta x Totem-16 Apple Integrated Map-16 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH05e04 aatttcccaaggnaaacaatccgtctgacttgatatttagatgactgtaacatggacaagtggatatgacatcgtggaag caaccccttttgttgagtggggtataaaaggagaagaccgtgtgaaatccccagctgggacattgaacttcgaccgcaac accatgtgtggtgtgtttgctctctctctctctctctctctctctctctctctctctctctcttgggggggatggttgag ggttgcatctcctgactatgccttatccatgttacgttctacaaacacaggttgcacccggcaaaaccgtggggttggcg aagatcctggatttatacacactgctttctgaaagaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
159:230:234 153:167:230 153:161:230 159:175 167 157:167 167 |
||||
Send comments to Luca Gianfranceschi
