CH05e06
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH05e06.F | ACACGCACAGAGACAGAGACAT | 22 nt | 62.1 °C | ![]() |
|
CH05e06.R | GTTGAATAGCATCCCAAATGGT | 22 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 125-222 | ||||
Number of alleles detected | 8 | ||||
Expected heterozygosity | 0.85 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 151 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-5 Fiesta-5 Fiesta x Totem-5 Royal Gala-5 Robusta5-5 Apple Integrated Map-5 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH05e06 aattttcacacacacgcacagagacagagacatagacacagagagagagagagagagagagagagagagagagagagaga tagagagagagagagagagagagacagagatacagagaatatgtaccggcctaaatgggaaaccaccatttgggatgcta ttcaacttattcttgagatgtgatacttcagctggtgcatctgatagtttcgtgtcatcaccatttacttctgtctcatt caaagtcccagactgaggagccagactaaatggaaactctggccgacctcctttttgtctgccgtttgaccttgagaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
134:216 216:222 125:150 150 140:150 125:146 140:146 |

