GD12
Primer features | |||||
Name | Sequence | Length | Tm | ||
GD12.F | TTGAGGTGTTTCTCCCATTGGA | 22 nt | 60.3 °C | ![]() |
|
GD12.R | CTAACGAAGCCGCCATTTCTTT | 22 nt | 60.3 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | unknown | ||||
Detected loci | |||||
Alleles size range | 141-191 | ||||
Number of alleles detected | 12 | ||||
Expected heterozygosity | 0.758 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 192 | ||||
Linkage group(s) | |||||
Developed by | USDA-ARS Plant Genetic Resources Unit, Cornell University, Geneva, NY, USA | ||||
Other maps | Fiesta x Totem-3 Malling9-3 | ||||
Reference publication | Hokanson S. C., Szewc-McFadden A. K., Lamboy W.F., J. R. McFerson J.R. (1998) Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus?domestica borkh. core subset collection. Theoretical and Applied Genetics 97(5-6): 671-683 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |

