GD147
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| GD147.F | TCCCGCCATTTCTCTGC | 17 nt | 54.8 °C |  |
|
| GD147.R | GTTTAAACCGCTGCTGCTGAAC | 22 nt | 62.1 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 135-155 | ||||
| Number of alleles detected | 6 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | USDA-ARS Plant Genetic Resources Unit, Cornell University, Geneva, NY, USA | ||||
| Other maps | Discovery-13 Fiesta x Totem-13 Apple Integrated Map-13 M.27 x M.116-13 | ||||
| Reference publication | Hokanson S. C., Szewc-McFadden A. K., Lamboy W.F., J. R. McFerson J.R. (1998) Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus?domestica borkh. core subset collection. Theoretical and Applied Genetics 97(5-6): 671-683 | ||||
| Remarks | dirty. SSR modified from:Hokanson et al.1998. Theor. Appl.Genet. 97:671-682 | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
147:151 141:153 141:153 141:135 155:151 147 135:153 141:153 |
||||
Send comments to Luca Gianfranceschi
