GD162
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| GD162.F | GAGGCAAGTGACAAAGAAAGATG | 23 nt | 61.1 °C |  |
|
| GD162.R | AAAATGTAACAACCCGTCCAAGTG | 24 nt | 61.8 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | unknown | ||||
| Detected loci | |||||
| Alleles size range | 215-254 | ||||
| Number of alleles detected | 13 | ||||
| Expected heterozygosity | 0.894 | ||||
| PCR annealing temp | 0 | ||||
| Sequenced allele size | 234 | ||||
| Linkage group(s) | |||||
| Developed by | USDA-ARS Plant Genetic Resources Unit, Cornell University, Geneva, NY, USA | ||||
| Other maps | Fiesta x Totem-4 Robusta5-4 | ||||
| Reference publication | Hokanson S. C., Szewc-McFadden A. K., Lamboy W.F., J. R. McFerson J.R. (1998) Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus?domestica borkh. core subset collection. Theoretical and Applied Genetics 97(5-6): 671-683 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
