Select a marker

GD6
Primer features
Name Sequence Length Tm  
GD6.F ATTTTGGAACACACACTCCCTCAGA 25 nt 64.1 °C Primer Stats
GD6.R GACGCCATACCCATTGACGATT 22 nt 62.1 °C
SSR info
SSR repeat type
Locus type SSR
Detected loci
Alleles size range
Number of alleles detected 0
Expected heterozygosity
PCR annealing temp
Sequenced allele size 0
Linkage group(s)
Developed by USDA-ARS Plant Genetic Resources Unit, Cornell University, Geneva, NY, USA
Other maps Fiesta x Totem-4 Malling9-4 Robusta5-4 Malling9-12 Robusta5-12 M.27 x M.116-4 M.27 x M.116-12
Reference publication Hemmat M, Weeden NF, Brown SK (2003) . J. AMER. SOC. HORT. SCI. 128(4): 515520
Remarks
Sequence
No sequence available
User's notes
THERE ARE NO USER'S NOTES.
Allele size and gel image
Cultivar Allele size
Not available


admin Send comments to Luca Gianfranceschi