MSS6
Primer features | |||||
Name | Sequence | Length | Tm | ||
MSS6.F | CGAAACTCAAAAACGAAATCAA | 22 nt | 54.7 °C | ![]() |
|
MSS6.R | ACGGGAGAGAAACTCAAGACC | 21 nt | 61.3 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 273-279 | ||||
Number of alleles detected | 3 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | HiDRAS consortium | ||||
Other maps | Discovery-4 M.27 x M.116-4 | ||||
Reference publication | Oddou-Muratorio, S; Aligon, C; Decroocq, S; Plomion, C; Lamant, T; Mush-Demesure, B (2001) Microsatellite primers for Sorbus torminalis and related species. Molecular Ecology Notes 1(4): 297-299 | ||||
Remarks | extra bands | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
279 277:273 279 279 279 273 279 279 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)