MSS6
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| MSS6.F | CGAAACTCAAAAACGAAATCAA | 22 nt | 54.7 °C |  |
|
| MSS6.R | ACGGGAGAGAAACTCAAGACC | 21 nt | 61.3 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 273-279 | ||||
| Number of alleles detected | 3 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | HiDRAS consortium | ||||
| Other maps | Discovery-4 M.27 x M.116-4 | ||||
| Reference publication | Oddou-Muratorio, S; Aligon, C; Decroocq, S; Plomion, C; Lamant, T; Mush-Demesure, B (2001) Microsatellite primers for Sorbus torminalis and related species. Molecular Ecology Notes 1(4): 297-299 | ||||
| Remarks | extra bands | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
279 277:273 279 279 279 273 279 279 |
||||
Send comments to Luca Gianfranceschi
