MdMYB9
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| MdMYB9.F | TCCATAACCTTCTTGGTAACAG | 22 nt | 58.4 °C |  |
|
| MdMYB9.R | AAGGAGAATCGGCTTTCGAT | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | |||||
| Locus type | |||||
| Detected loci | |||||
| Alleles size range | |||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | |||||
| PCR annealing temp | |||||
| Sequenced allele size | 329 | ||||
| Linkage group(s) | |||||
| Developed by | Horticulture and Food Research Institute of New Zealand | ||||
| Other maps | |||||
| Reference publication | Chagn� D, Carlisle CM, Blond C, Volz RK, Whitworth CJ, Oraguzie NC, Crowhurst RN, Allan AC, Espley RV, Hellens RP, Gardiner SE (2007) Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple.. BMC Genomics 8(): 212 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
