NB102a
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| NB102a.F | TGTTATCACCTGAGCTACTGCC | 22 nt | 62.1 °C |  |
|
| NB102a.R | CTTCCTCTTTATTTGCCGTCTT | 22 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | presumed multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 181-183 | ||||
| Number of alleles detected | 3 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | HiDRAS consortium | ||||
| Other maps | Discovery-16 | ||||
| Reference publication | Testolin, R; Marrazzo, T; Cipriani, G; Quarta, R; Verde, I; Te Dettori, M; Pancaldi, M; Sansavini, S (2000) Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43(3): 512-520 | ||||
| Remarks | extra bands | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
181 181:183 null null 183 183 181 183 |
||||
Send comments to Luca Gianfranceschi
