NB102a
Primer features | |||||
Name | Sequence | Length | Tm | ||
NB102a.F | TGTTATCACCTGAGCTACTGCC | 22 nt | 62.1 °C | ![]() |
|
NB102a.R | CTTCCTCTTTATTTGCCGTCTT | 22 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | presumed multi-locus | ||||
Detected loci | |||||
Alleles size range | 181-183 | ||||
Number of alleles detected | 3 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | HiDRAS consortium | ||||
Other maps | Discovery-16 | ||||
Reference publication | Testolin, R; Marrazzo, T; Cipriani, G; Quarta, R; Verde, I; Te Dettori, M; Pancaldi, M; Sansavini, S (2000) Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43(3): 512-520 | ||||
Remarks | extra bands | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
181 181:183 null null 183 183 181 183 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)