NH005b
Primer features | |||||
Name | Sequence | Length | Tm | ||
NH005b.F | TGAGAAGAATTAGCCATGATGA | 22 nt | 56.5 °C | ![]() |
|
NH005b.R | TTACTACTTGCGTGCGTTCC | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | |||||
Detected loci | |||||
Alleles size range | |||||
Number of alleles detected | 3 | ||||
Expected heterozygosity | 0.62 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 338 | ||||
Linkage group(s) | |||||
Developed by | Dep. of Breeding, National Institute of Fruit Tree Science, Ibaraki, Japan | ||||
Other maps | Fiesta x Totem-8 Malling9-8 Robusta5-8 M.27 x M.116-8 | ||||
Reference publication | Yamamoto, T; Kimura, T; Shoda, M; Ban, Y; Hayashi, T; Matsuta, N (2002) Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes 2(1): 14-16 | ||||
Remarks | * markers developed in pear. Heterozygousity and allele number refer to pear and they were taken from the reference paper by Yamamoto et al.(2002) | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)