NH011b
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| NH011b.F | GGTTCACATAGAGAGAGAGAG | 21 nt | 59.4 °C |  |
|
| NH011b.R | TTTGCCGTTGGACCGAGC | 18 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | |||||
| Detected loci | |||||
| Alleles size range | |||||
| Number of alleles detected | 5 | ||||
| Expected heterozygosity | 0.76 | ||||
| PCR annealing temp | 55 | ||||
| Sequenced allele size | 181 | ||||
| Linkage group(s) | |||||
| Developed by | Dep. of Breeding, National Institute of Fruit Tree Science, Ibaraki, Japan | ||||
| Other maps | Fiesta x Totem-4 Malling9-4 | ||||
| Reference publication | Yamamoto, T; Kimura, T; Shoda, M; Ban, Y; Hayashi, T; Matsuta, N (2002) Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes 2(1): 14-16 | ||||
| Remarks | * markers developed in pear. Heterozygousity and allele number refer to pear and they were taken from the reference paper by Yamamoto et al.(2002) | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Not available |
|||||
Send comments to Luca Gianfranceschi
