NH029a
Primer features | |||||
Name | Sequence | Length | Tm | ||
NH029a.F | GAAGAAAACCAGAGCAGGGCA | 21 nt | 61.3 °C | ![]() |
|
NH029a.R | CCTCCCGTCTCCCACCATATTAG | 23 nt | 66.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 91-193 | ||||
Number of alleles detected | 7 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | HiDRAS consortium | ||||
Other maps | Discovery-9 Fiesta x Totem-9 Malling9-9 Robusta5-9 Apple Integrated Map-9 | ||||
Reference publication | Yamamoto, T; Kimura, T; Shoda, M; Ban, Y; Hayashi, T; Matsuta, N (2002) Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes 2(1): 14-16 | ||||
Remarks | clean, compl. band(s) | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
91 93:99 nd 91 97 193 93:95 93:95 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)