NH033b
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| NH033b.F | GTCTGAAACAAAAAGCATCGCAA | 23 nt | 59.3 °C |  |
|
| NH033b.R | CTGCCTCGTCTTCCTCCTTATCTCC | 25 nt | 69.1 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 163-189 | ||||
| Number of alleles detected | 7 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 0 | ||||
| Linkage group(s) | |||||
| Developed by | HiDRAS consortium | ||||
| Other maps | Discovery-2 Malling9-2 Apple Integrated Map-2 | ||||
| Reference publication | Yamamoto, T; Kimura, T; Shoda, M; Ban, Y; Hayashi, T; Matsuta, N (2002) Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes 2(1): 14-16 | ||||
| Remarks | clean | ||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
189 175:183 177:189 163:177 163:177 175:183 183:189 177:187 |
||||
Send comments to Luca Gianfranceschi
