NZ02b1
Primer features | |||||
Name | Sequence | Length | Tm | ||
NZ02b1.F | CCGTGATGACAAAGTGCATGA | 21 nt | 59.4 °C | ![]() |
|
NZ02b1.R | ATGAGTTTGATGCCCTTGGA | 20 nt | 56.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 212-238 | ||||
Number of alleles detected | 7 | ||||
Expected heterozygosity | 0.75 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 238 | ||||
Linkage group(s) | |||||
Developed by | HortResearch NZ | ||||
Other maps | Braeburn-5 Telamon-5 Fiesta-15 Prima-15 Discovery-15 Fiesta-15 Prima-15 Fiesta x Totem-15 Malling9-15 Apple Integrated Map-15 M.27 x M.116-15 | ||||
Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
220:231 220:239 225:233 229 219:229 229:239 219:239 |

