NZ03c1
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| NZ03c1.F | GCTCTCATCTTCACAGATAA | 20 nt | 54.3 °C |  |
|
| NZ03c1.R | AGACCCGGAAAATTCTAT | 18 nt | 49.3 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | multi-locus | ||||
| Detected loci | |||||
| Alleles size range | |||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | ND | ||||
| PCR annealing temp | 50 | ||||
| Sequenced allele size | 168 | ||||
| Linkage group(s) | |||||
| Developed by | HortResearch NZ | ||||
| Other maps | Discovery-6 Fiesta-1 Fiesta-2 Fiesta-6 Fiesta x Totem-10 Fiesta x Totem-16 M.27 x M.116-1 M.27 x M.116-2 M.27 x M.116-6 M.27 x M.116-10 | ||||
| Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
73:89:117 85:117 73:85:99 85:105 73:85:89 73:85:103 73:111 |
||||
Send comments to Luca Gianfranceschi
