NZ05g8
Primer features | |||||
Name | Sequence | Length | Tm | ||
NZ05g8.F | CGGCCATCGATTATCTTACTCTT | 23 nt | 61.1 °C | ||
NZ05g8.R | GGATCAATGCACTGAAATAAACG | 23 nt | 59.3 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 115-147 | ||||
Number of alleles detected | 6 | ||||
Expected heterozygosity | 0.76 | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 121 | ||||
Linkage group(s) | |||||
Developed by | HortResearch NZ | ||||
Other maps | Discovery-4 Braeburn-16 Telamon-16 Fiesta-4 Prima-4 Discovery-4 Fiesta-4 Fiesta x Totem-4 | ||||
Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
116:128 122:nul 116:136 116:122 116:122 122 122:142 |
Send comments to Luca Gianfranceschi