NZ05g8
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| NZ05g8.F | CGGCCATCGATTATCTTACTCTT | 23 nt | 61.1 °C |  |
|
| NZ05g8.R | GGATCAATGCACTGAAATAAACG | 23 nt | 59.3 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 115-147 | ||||
| Number of alleles detected | 6 | ||||
| Expected heterozygosity | 0.76 | ||||
| PCR annealing temp | 55 | ||||
| Sequenced allele size | 121 | ||||
| Linkage group(s) | |||||
| Developed by | HortResearch NZ | ||||
| Other maps | Discovery-4 Braeburn-16 Telamon-16 Fiesta-4 Prima-4 Discovery-4 Fiesta-4 Fiesta x Totem-4 | ||||
| Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
116:128 122:nul 116:136 116:122 116:122 122 122:142 |
||||
Send comments to Luca Gianfranceschi
