NZ23g4
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| NZ23g4.F | TTTCTCTCTCTTTCCCAACTC | 21 nt | 57.4 °C |  |
|
| NZ23g4.R | AGCCGCCTTGCATTAAATAC | 20 nt | 56.4 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 84-116 | ||||
| Number of alleles detected | 9 | ||||
| Expected heterozygosity | 0.76 | ||||
| PCR annealing temp | 50 | ||||
| Sequenced allele size | 88 | ||||
| Linkage group(s) | |||||
| Developed by | HortResearch NZ | ||||
| Other maps | Braeburn-7 Telamon-7 Fiesta-6 Prima-6 Discovery-6 Fiesta-6 Malling9-6 Robusta5-6 Apple Integrated Map-6 M.27 x M.116-6 | ||||
| Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
n.d. 85/99 85/119 n.d. n.d. n.d. n.d. |
||||
Send comments to Luca Gianfranceschi
