NZ26c6
Primer features | |||||
Name | Sequence | Length | Tm | ||
NZ26c6.F | GACGAAGAACTCGCCGGAGC | 20 nt | 64.6 °C | ||
NZ26c6.R | CGAGGACCAACCCACACACAA | 21 nt | 63.3 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | |||||
Number of alleles detected | 0 | ||||
Expected heterozygosity | ND | ||||
PCR annealing temp | 50 | ||||
Sequenced allele size | 136 | ||||
Linkage group(s) | |||||
Developed by | HortResearch NZ | ||||
Other maps | Fiesta x Totem-3 Fiesta x Totem-6 Fiesta x Totem-16 | ||||
Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
Remarks | |||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |
Send comments to Luca Gianfranceschi