NZ28f4
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| NZ28f4.F | TGCCTCCCTTATATAGCTAC | 20 nt | 56.4 °C |  |
|
| NZ28f4.R | TGAGGACGGTGAGATTTG | 18 nt | 53.8 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 112 | ||||
| Number of alleles detected | 4 | ||||
| Expected heterozygosity | 0.67 | ||||
| PCR annealing temp | 50 | ||||
| Sequenced allele size | 112 | ||||
| Linkage group(s) | |||||
| Developed by | HortResearch NZ | ||||
| Other maps | Discovery x TN10-8-12 Fiesta x Discovery-12 Braeburn-10 Telamon-10 Fiesta-12 Prima-12 Discovery-12 Fiesta-12 Fiesta x Totem-12 Robusta5-12 Apple Integrated Map-12 | ||||
| Reference publication | Guilford, P.; Prakash, S.; Zhu, J. M.; Rikkerink, E.; Gardiner, S.; Bassett, H.; Forster, R. (1997) Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics 94(2): 249-254 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
98:112 100:110 98:104 110:112 98:110 110:112 98:112 |
||||
Send comments to Luca Gianfranceschi
