Select a marker

NZmsEB106753
Primer features
Name Sequence Length Tm  
NZmsEB106753.F TCTGAGGCTCCCAAGTCC 0 nt 58.4 °C Primer Stats
NZmsEB106753.R TAGGAGCAGAAGAGGTGACG 0 nt 60.5 °C
SSR info
SSR repeat type
Locus type
Detected loci
Alleles size range
Number of alleles detected 0
Expected heterozygosity
PCR annealing temp Td 6560
Sequenced allele size 175
Linkage group(s)
Developed by Horticulture and Food Research Institute of New Zealand
Other maps Northern Spy-8 Discovery-8 Malling9-8 Robusta5-8
Reference publication (2008) Genome mapping of three major resistance genes to woolly apple aphid (Eriosoma lanigerum Hausm.). Tree Genetics & Genomes 4(): 233236
Remarks
Sequence
>gi|90996332|gb|EB106753.1|EB106753 000303AVBB005600HT (AVBB) Royal Gala young shoot Malus x domestica cDNA clone AVBB005600, mRNA sequence CGGCAGCGACCCCAGCCGCCACCCCAGCAGCGACCACATCCGCCACCCCAGCAGCGACCCCATCCTCCAC CCAAGCAGCGACCCCATCCGCCACCCCAGCAGCGACCCCATCCGCCACACAAGCAGCGACCCCATCCGCC ACCCCAGCAGCGACCCCATCCGCCTCCTCTGAGGCTCCCAAGTCCTCGGCTTCATCAACCTCTCCGTCCT CCGCCCCCACCACCTCCTCCTCCTCCTCCTCCTCCTCCCCATCCAGCTCTCCATCATCCGATTCTCCACC CTCACCACCCACCTCCACTCCCGCCTCCGGCCCATCCTCCGACGTCACCTCTTCTGCTCCTACCGAGTCG ACTACGTCTGCTGAGGCTCCCGCCCCATCTGGTGCAGCCGTGAACAGAGGCTTCTCTGCCGGTTCCGTGG TCGCCGTCGTCATCGCGG
User's notes
THERE ARE NO USER'S NOTES.
Allele size and gel image
Cultivar Allele size
Not available


admin Send comments to Luca Gianfranceschi