Select a marker

SAmsCN917681
Primer features
Name Sequence Length Tm  
SAmsCN917681.F CTCCATTTACAACCAAAGGG 20 nt 56.4 °C Primer Stats
SAmsCN917681.R TCCGTGGCAGACTTTTCGG 19 nt 59.5 °C
SSR info
SSR repeat type
Locus type single locus
Detected loci
Alleles size range 409434
Number of alleles detected 0
Expected heterozygosity
PCR annealing temp
Sequenced allele size 0
Linkage group(s)
Developed by East Malling Research (UK)
Other maps M.27 x M.116-5
Reference publication (2012) A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree Genetics & Genomes 8(5): 9911002
Remarks
Sequence
>gi_48390181_gb_CN917681.1_CN917681 CACAACTTCCTCCATTTACAACCAAAGGGTAGAAGAAATTTTCTTCTCTTCTTCTTCTTCTTCT TCTTCTTCTTCAATTTTCATATTGGAGATGGGTTCCCATGTCTCGAAGCAGGTAGAACGTCGGA AGGCGATCGCGCTGGAAAAACACACACTGTGTGATCTTCACCAGAGCTGTGGTGAAGAGTTTCC ATCATGTGCCTACAAGCCTTCGGACAGAAAAAGCTGGATGGCTGGGATCAACCCTGAGAAACTT CACATAAATAAGATTGTATGGCCTGGAACTCATGACTCTGCAACCAACAAGATTGGATTTCCGT TCATCACTAGGCCTTTTGCTCAGTGTCAAAATCTGTCCATCTACCAGCAGCTCGAGAAGGGCGC CAGAGCTCTCGATATTCGAATCCAGAAGGACCGAAAAGTCTGCCACGGAGTCCTCCTCACTTAC AACGTTGATGCTGTGATCAGCGACGTCAAGAAGTTTTTGTCCGAAACGCAGTATGAGATCATAA TACTCGAAATCCGAACTGAATTCGGACACGAAGATCCTCCTGAATTTGATAAGTACTTGGTTGA TCAGCTCGGCGAGTTTTTAATCCCCCAAGATGATCATGTTTTCGACAAGACTATTTCGGAACTG CTGCCGAAGAGAGTGATATGCGTGTGGAA
User's notes
THERE ARE NO USER'S NOTES.
Allele size and gel image
Cultivar Allele size
Not available


admin Send comments to Luca Gianfranceschi