Select a marker

SAmsCN925672
Primer features
Name Sequence Length Tm  
SAmsCN925672.F ACACGGTAAACACTACCACC 20 nt 58.4 °C Primer Stats
SAmsCN925672.R GCGAACTTCACCTTCGCAAA 20 nt 58.4 °C
SSR info
SSR repeat type
Locus type single locus
Detected loci
Alleles size range 305314
Number of alleles detected 0
Expected heterozygosity
PCR annealing temp
Sequenced allele size 0
Linkage group(s)
Developed by East Malling Research (UK)
Other maps
Reference publication (2012) A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree Genetics & Genomes 8(5): 9911002
Remarks
Sequence
>gi_48398485_gb_CN925672.1_CN925672 GAACTTGTGATGAGAGAATATGAGGAGGATCCCACACGCTGTCAACACGGTAAACACTACCACC TTAATCTCTCCCTCCCTCCCTCCCTCCTATCGAACCCGACCAAGAAGCTGCAACAAACACTGAG TTATAATCTTTAGATCCTTTGCGCGGGAACAAGTTGGAAATTTCGGACCGTGGGATCTGGATAG TGCGGTAAGGAAGGGGCGCAAGATGAGCGTGAAGGGGCCGAGGATGAGGACCCGCTTGGGGAAG TACGAGCTGGGGAAAACGCTGGGAGAGGGAACGTTTGCGAAGGTGAAGTTCGCCAAGAACATGG AGACCGGGCAGTGCGTCGCCATTAAAATCGTCCACCGTGAGCAAGTCCTCAGAAACAAGATGAT CGAACACGTACGTAATAAAACATAAATTGTTCAGTTGGTTGAAACACATTAAAATGTGTGTAAA AACGTGTGTCCCCATATCCTAATCCTTATATAATGTGCTTTTTTCTTCTAATCAATCAAAATGT ACGTAGGAATGTCGTTCAGAATGATTTGGTATGAATCACTTCTGCGCATAATCGTTTTTATTGT TTTAGGTTTTGAAAAGGTTTTTAAGTTTTTCTGCCAAATGCAAAAGGAGGCGCTGGTAAACAGT ACATGCCTTTAATCAT
User's notes
THERE ARE NO USER'S NOTES.
Allele size and gel image
Cultivar Allele size
Not available


admin Send comments to Luca Gianfranceschi