Select a marker

SAmsCO417416
Primer features
Name Sequence Length Tm  
SAmsCO417416.F GACCTCAGTCCAAGTCTCC 19 nt 59.5 °C Primer Stats
SAmsCO417416.R CTGAATCTCTGCCGGAAGG 19 nt 59.5 °C
SSR info
SSR repeat type
Locus type single locus
Detected loci
Alleles size range 213233
Number of alleles detected 0
Expected heterozygosity
PCR annealing temp
Sequenced allele size 0
Linkage group(s)
Developed by East Malling Research (UK)
Other maps M.27 x M.116-12
Reference publication (2012) A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree Genetics & Genomes 8(5): 9911002
Remarks
Sequence
>gi_49633664_gb_CO417416.1_CO417416 TCTCCCTCCTCCATGAGGGGACCTCAGTCCAAGTCTCCAAAGCATGACTCTTGGTCTCTGACAC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTACACACCCTTCAATCTTGCAAGCCTAACCT GTGTCCTTAAACTGATTAAACTTTCTTCGGTGCATTTAATTTTGTTGGTAACAAATTTCCAGCA TAAACAATCTTAATGGAGTCGATGTGCACCTAATCCAACAAAAACTACTTCCTTAAATCCTCAA ATTCCATCAAATATTTCTTCAATTTAGTATTAGAAACACCCCAAGGCTCCAAACTTTATCTCTG AATGCTCTGTTCTTTGCCTTCCGGCAGAGATTCAGCTTCTGGGTTTTTGAAATTTTAACCTCCG AAAATGTCCCAAGTCTATTTAGAGCAAGGGCCCCACCGCCGCTCCTT
User's notes
THERE ARE NO USER'S NOTES.
Allele size and gel image
Cultivar Allele size
Not available


admin Send comments to Luca Gianfranceschi