Select a marker

SAmsCO723438
Primer features
Name Sequence Length Tm  
SAmsCO723438.F TCCGATTCTCTATCAGATCCAT 22 nt 58.4 °C Primer Stats
SAmsCO723438.R TGGATCGGGACATGGAAGG 19 nt 59.5 °C
SSR info
SSR repeat type
Locus type single locus
Detected loci
Alleles size range 197203
Number of alleles detected 0
Expected heterozygosity
PCR annealing temp
Sequenced allele size 0
Linkage group(s)
Developed by East Malling Research (UK)
Other maps M.27 x M.116-15
Reference publication (2012) A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree Genetics & Genomes 8(5): 9911002
Remarks
Sequence
>gi_50703475_gb_CO723438.1_CO723438 CCAAAAGTTCACATGTACCAATCCGACTCCGAGACGAAGAATGATAGTTAAAGGTATAAATTGG CGAGGGTCGGAAGCAGCCTGAAACCCGAGAACTCCTCTCCACTGTCGTCTCCGCCCCTCACAGG GCTGCTCTCTCTCTATCTCACTCAATCTTCCCACCAAAGACCTCAACCAAACTAAACAAGATTG CGACAACTAATCAAAATCAAATGGCAGAGGGTGAATCCCCGTCGTCCGATTCTCTATCAGATCC ATCCCTATCCCGAAACGTTTCCTTCAGTCGCCTCAACGCCCAGGCGGCGGAGTTCATCCCCAAT CGCAGCGCCACTGCGCACGCATCCGCACCGGCAGCGCCTCCTGCGGCTGTAGGTCAAGTCCACG TCTACCCTCCGCCGCCGCCGCCGCCGCCTTCGGCCCCCTTCCATGTCCCGATCCAGGCCGTCCC TCCTCCTCCTCCACCTCCTCCTCTCGTGGTTCCGGTCCCAGTTCATCCGCATCATCACTTGCCG GTCCAGTACCATCATCACAATCAGTATCATTACTCTGGATTTGGAGACC
User's notes
THERE ARE NO USER'S NOTES.
Allele size and gel image
Cultivar Allele size
Not available


admin Send comments to Luca Gianfranceschi