SdSSR
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| SdSSR.F | GAATTCTCGTCCCTTCATCTC | 21 nt | 59.4 °C |  |
|
| SdSSR.R | GTTCCTTAGCCTCCCATTCTG | 21 nt | 61.3 °C | ||
| SSR info | |||||
| SSR repeat type | unknown | ||||
| Locus type | |||||
| Detected loci | |||||
| Alleles size range | |||||
| Number of alleles detected | 0 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 181 | ||||
| Linkage group(s) | |||||
| Developed by | |||||
| Other maps | Fiesta x Totem-7 M.27 x M.116-7 | ||||
| Reference publication | Cevik V, King J. (2002) High-resolution genetic analysis of the Sd-1 aphid resistance locus in Malus spp.. Theoretical and Applied Genetics 105(2-3): 346-354 | ||||
| Remarks | |||||
| Sequence | |||||
| No sequence available | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
179:176 181:203 |
||||
Send comments to Luca Gianfranceschi
