UDP98-416
Primer features | |||||
Name | Sequence | Length | Tm | ||
UDP98-416.F | TTTTCTCAGCAGCCAAACAA | 20 nt | 54.3 °C | ![]() |
|
UDP98-416.R | ATGTTTCGTGCTTCTGCTCC | 20 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | unknown | ||||
Locus type | |||||
Detected loci | |||||
Alleles size range | 96-114 | ||||
Number of alleles detected | 4 | ||||
Expected heterozygosity | 0.17 | ||||
PCR annealing temp | 57 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | Dipartimento di Produzione vegetale e tecnologie agrarie, University of Udine, Udine, Italy | ||||
Other maps | Fiesta x Totem-11 M.27 x M.116-11 | ||||
Reference publication | Testolin, R; Marrazzo, T; Cipriani, G; Quarta, R; Verde, I; Te Dettori, M; Pancaldi, M; Sansavini, S (2000) Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43(3): 512-520 | ||||
Remarks | SSR marker developed in peach | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Not available |

