CH04d10
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH04d10.F | GAGGCATCTGTAGCTCCGAC | 20 nt | 62.5 °C |  |
|
| CH04d10.R | TGGTGAGTATCTGCTCGCTG | 20 nt | 60.5 °C | ||
| SSR info | |||||
| SSR repeat type | Imperfect | ||||
| Locus type | presumed multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 138-204 | ||||
| Number of alleles detected | 10 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 186 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Fiesta-11 Fiesta x Totem-11 Apple Integrated Map-11 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH04d10 aattgaccacttgaagctggaaatgtaaagcctgaggcatctgtagctccgaccacattcacccggccagttccatcatc ctggtatacaaaatcaaggaaccaccatcaccatcnaagcacaacaatgaacatgtgagagagagagagagagagagagg gagagagagagagagagagagagagagagagagaggtgacagcgagcagatactcaccaaataccagggcacttctttac attctgaaagttagcgaagtataacccatctgccactcacctttctcgttgcgtttcagaaacctttgtgctgcctaaag aagaatcgatatcaaaaatcaccagttaaagaaagcactcaaaatt | |||||
| User's notes | |||||
| Luca Gianfranceschi (luca.gianfranceschi@unimi.it) Date 13 September 2005 - Time: 15:09 Forward primer sequence was wrong. Please use the new one. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size | ||||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
141:164:202 150:162 160:160 138:160:204 141:164:186 202:204 162:204 |
||||
Send comments to Luca Gianfranceschi
