CH04c07
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH04c07.F | GGCCTTCCATGTCTCAGAAG | 20 nt | 60.5 °C | ![]() |
|
CH04c07.R | CCTCATGCCCTCCACTAACA | 20 nt | 60.5 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 98-135 | ||||
Number of alleles detected | 8 | ||||
Expected heterozygosity | 0.82 | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 114 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-14 Fiesta-14 Fiesta x Totem-14 PI 613988-14 Royal Gala-14 Apple Integrated Map-14 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH04c07 aattgctgcagccattgacatggccttccatgtctcagaaggacacattgtttcagaagtagagagagagagagagagag agagagagagagagagagagagagaggtgtttaaatgttagtggagggcatgagggtgagagtgggggcactatatagat ggagagaaacttacctaaaccaatgccattgtagactttgcagttgtattttcaagtccaccgcgtattgtcaaacgttt tgattcngtcacgataatgtgtgcttagcctactataatgttattgtgacagtatttcaaatcaatcacctactgtcatg cattttaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
106:108 108:113 108:110 108:110 113:135 104:135 119:135 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)