CH05g07
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH05g07.F | CCCAAGCAATATAGTGAATCTCAA | 24 nt | 60.1 °C | ![]() |
|
CH05g07.R | TTCATCTCCTGCTGCAAATAAC | 22 nt | 58.4 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | multi-locus | ||||
Detected loci | |||||
Alleles size range | 149-197 | ||||
Number of alleles detected | 10 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 176 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Discovery-12 Discovery-14 Fiesta-12 Fiesta-14 Fiesta x Totem-12 Fiesta x Totem-14 Malling9-12 Robusta5-14 Apple Integrated Map-12 Apple Integrated Map-14 M.27 x M.116-12 M.27 x M.116-14 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH05g07 aattccaatttcccaagcaatatagtgaatctcaaatggtacatgttccatccaacaacacaactctctctctctctctc tctctctctctctctctctctctctccctctccactaacaaagcaaaagggnatcgtatgcatccccaacaaaaagctga tgcatgttatttgcagcaggagatgaaaagcctatttcaactatacttggaacaaaatataccccaacccttgtcttgct ttcctgttatctttgcctttagattgccaccaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
155:163 151:155:173:197 155:163:173:197 155:163:173 155:171:179 155:171:179 155:165:179 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)