CH01a09
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH01a09.F | GATGTGGTTCCAGAAGCTAC | 20 nt | 58.4 °C | ![]() |
|
CH01a09.R | CACATGCATGAAAAGCATAT | 20 nt | 52.3 °C | ||
SSR info | |||||
SSR repeat type | Compound | ||||
Locus type | presumed multi-locus | ||||
Detected loci | |||||
Alleles size range | 198-384 | ||||
Number of alleles detected | 10 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 55 | ||||
Sequenced allele size | 198 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta x Totem-14 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH01a09 tagtctgcaaagaaggtaaccactgaagatgatgtggttccagaagctactcctgctatactgtataggtactctcatat tctgttattgtctttgtctaaaactcttgattttttagtaaatggcgatctctctctctctctctctctctctctctctc tcacacacacacacacacacacacacgtgtgtgtgngcgcgcatgatnatatgcttttcatgcatgtgnatctgcatgta ntntgtggnatactaagcacatgctcccnacacttgtntntgtgttctgtgttctgtctgtgtgccggaaaacaaaatat ctacttatatttaatctctggtataatcctccatanggtgcctaatt | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
204 198:204 200:204:360 204:210:276 200:204:360 200:204:360 200:204:360:370 |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)