CH04d10
Primer features | |||||
Name | Sequence | Length | Tm | ||
CH04d10.F | GAGGCATCTGTAGCTCCGAC | 20 nt | 62.5 °C | ||
CH04d10.R | TGGTGAGTATCTGCTCGCTG | 20 nt | 60.5 °C | ||
SSR info | |||||
SSR repeat type | Imperfect | ||||
Locus type | presumed multi-locus | ||||
Detected loci | |||||
Alleles size range | 138-204 | ||||
Number of alleles detected | 10 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 186 | ||||
Linkage group(s) | |||||
Developed by | ETH Zuerich | ||||
Other maps | Fiesta-11 Fiesta x Totem-11 Apple Integrated Map-11 | ||||
Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
Remarks | none | ||||
Sequence | |||||
>CH04d10 aattgaccacttgaagctggaaatgtaaagcctgaggcatctgtagctccgaccacattcacccggccagttccatcatc ctggtatacaaaatcaaggaaccaccatcaccatcnaagcacaacaatgaacatgtgagagagagagagagagagagagg gagagagagagagagagagagagagagagagagaggtgacagcgagcagatactcaccaaataccagggcacttctttac attctgaaagttagcgaagtataacccatctgccactcacctttctcgttgcgtttcagaaacctttgtgctgcctaaag aagaatcgatatcaaaaatcaccagttaaagaaagcactcaaaatt | |||||
User's notes | |||||
Luca Gianfranceschi (luca.gianfranceschi@unimi.it) Date 13 September 2005 - Time: 15:09 Forward primer sequence was wrong. Please use the new one. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ||||
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
141:164:202 150:162 160:160 138:160:204 141:164:186 202:204 162:204 |
Send comments to Luca Gianfranceschi