CH05e05
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH05e05.F | TCCTAGCGATAGCTTGTGAGAG | 22 nt | 62.1 °C |  |
|
| CH05e05.R | GAAACCACCAAACCGTTACAAT | 22 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | Perfect | ||||
| Locus type | single locus | ||||
| Detected loci | |||||
| Alleles size range | 138-160 | ||||
| Number of alleles detected | 7 | ||||
| Expected heterozygosity | 0.82 | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 150 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery-14 Fiesta-14 Fiesta x Totem-14 Malling9-14 Apple Integrated Map-14 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH05e05 aattcagttacacagaaaggaggagagagaacagtggagggaggagacagggtcagagttaaagcataaacaaagtcgcg tataataagacgcgcgcaaagcggtctgtaacggcgttttcttctactggatttcctagcgatagcttgtgagagtgttt ttagagagagagagagagagagagagagagagagagagagggtgtgagagttttttgagagagggagggagaaaggcggt tttccgagcagagatagcggtattgtaacggtttggtggtttcggcgttaacggttcttatcgatcagtgatcgttacac gaaatattgtgttgaagcgagaaaaaattggaagttggtgggagctttgtgttgattaaaatccgtattaacggctttat taaggaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
142:160 142:147 140:151 138 142:148 148:160 138:148 |
||||
Send comments to Luca Gianfranceschi
