CH05g07
| Primer features | |||||
| Name | Sequence | Length | Tm | ||
| CH05g07.F | CCCAAGCAATATAGTGAATCTCAA | 24 nt | 60.1 °C |  |
|
| CH05g07.R | TTCATCTCCTGCTGCAAATAAC | 22 nt | 58.4 °C | ||
| SSR info | |||||
| SSR repeat type | Imperfect | ||||
| Locus type | multi-locus | ||||
| Detected loci | |||||
| Alleles size range | 149-197 | ||||
| Number of alleles detected | 10 | ||||
| Expected heterozygosity | n.d. | ||||
| PCR annealing temp | 60 | ||||
| Sequenced allele size | 176 | ||||
| Linkage group(s) | |||||
| Developed by | ETH Zuerich | ||||
| Other maps | Discovery-12 Discovery-14 Fiesta-12 Fiesta-14 Fiesta x Totem-12 Fiesta x Totem-14 Malling9-12 Robusta5-14 Apple Integrated Map-12 Apple Integrated Map-14 M.27 x M.116-12 M.27 x M.116-14 | ||||
| Reference publication | Liebhard, R. Gianfranceschi, L. Koller, B. Ryder, C. D. Tarchini, R. Weg, E. van de Gessler, C. (2002) Development and characterization of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding 10(4): 217-241 | ||||
| Remarks | none | ||||
| Sequence | |||||
| >CH05g07 aattccaatttcccaagcaatatagtgaatctcaaatggtacatgttccatccaacaacacaactctctctctctctctc tctctctctctctctctctctctctccctctccactaacaaagcaaaagggnatcgtatgcatccccaacaaaaagctga tgcatgttatttgcagcaggagatgaaaagcctatttcaactatacttggaacaaaatataccccaacccttgtcttgct ttcctgttatctttgcctttagattgccaccaatt | |||||
| User's notes | |||||
| THERE ARE NO USER'S NOTES. | |||||
| Allele size and gel image | |||||
| Cultivar | Allele size |  | |||
|
Prima Fiesta Discovery Durello di Forlí TN10-8 Florina Nova Easygro Starking |
155:163 151:155:173:197 155:163:173:197 155:163:173 155:171:179 155:171:179 155:165:179 |
||||
Send comments to Luca Gianfranceschi
