Hi02c06
Primer features | |||||
Name | Sequence | Length | Tm | ||
Hi02c06.F | AGCAAGCGGTTGGAGAGA | 18 nt | 56.1 °C | ![]() |
|
Hi02c06.R | GTTTGCAACAGGTGGACTTGCTCT | 24 nt | 65.2 °C | ||
SSR info | |||||
SSR repeat type | Perfect | ||||
Locus type | single locus | ||||
Detected loci | |||||
Alleles size range | 208-252 | ||||
Number of alleles detected | 8 | ||||
Expected heterozygosity | n.d. | ||||
PCR annealing temp | 60 | ||||
Sequenced allele size | 0 | ||||
Linkage group(s) | |||||
Developed by | HiDRAS consortium | ||||
Other maps | Discovery-11 Fiesta-11 Malling9-11 Robusta5-11 Apple Integrated Map-11 | ||||
Reference publication | Silfverberg-Dilworth E, Matasci C L, Van de Weg W E, Van Kaauwen M P W,Walser M, Kodde L P, Soglio V, Gianfranceschi L, Durel C E, Costa F, Yamamoto T, Koller B, Gessler C, Patocchi A (2006) Microsatellite markers spanning the apple (Malus x domestica Borkh) genome. Tree Genetics & Genomes 2(4): 202-224 | ||||
Remarks | clean | ||||
Sequence | |||||
No sequence available | |||||
User's notes | |||||
THERE ARE NO USER'S NOTES. | |||||
Allele size and gel image | |||||
Cultivar | Allele size | ![]() | |||
Fiesta Discovery Gala Florina Nova Easygro TN10-8 Durello di Forli Prima Modial Gala Fuji |
230:244 230:242 212:242 (fromT42) 252 208:242 242:252 227:242 nd |
![admin](../../images/icons/groupkey.png)
![](../../images/icons/back 2.jpg)